![]()
0 Comments
![]() ![]() IT 5 s, Competitive Elution with 1 µg/mL free alpha toxin, 5 sĬGATGC CT ¯ ¯T TA ¯ ¯CGG TC ¯ ¯TAG T ¯ ¯TTGGATGTAGCCAGTCAGTGTTAAGGAGTGC IT 5 s, Competitive Elution with 20 µg/mL free BSA, 24 h IT 5 s, Competitive Elution with 2.5 µg/mL free alpha toxin, 5 s IT 5 s, Competitive Elution with 20 µg/mL free toxin B, 6 h IT 5 s, Competitive Elution with 5 µg/mL free alpha toxin, 5 s IT 5 s, Competitive Elution with 20 µg/mL free cholera toxin, 6 h IT 5 s, Competitive Elution with 10 µg/mL free alpha toxin, 5 s IT 5 s, Competitive Elution with 20 µg/mL free exotoxin a, 6 h IT 5 s, Competitive Elution with 1 mg/mL free alpha toxin, 5 s IT 5 min, Competitive Elution with 1 mg/mL free BSA, 5 min IT 5 min, Competitive Elution with 1 mg/mL free alpha toxin, 5 min The random region of R12.06 also shares approximately 30% and 50% identity with the random regions of R12.26 and R12.02 respectively.īSA Immobilized Negative Target (INT) 22 h The entire random region of R12.06 participated in the formation of the long stem-loop secondary structure according to the Mfold prediction. The Mfold predicted secondary structure showed a long stem-loop structure comprised of the random region of the MRE and with a Gibbs free energy value of −8.85 kcal/mol ( Figure 2). The random region of one sequence, R12.06 from the analyzed Round 12 library appeared to be highly conserved among several sequence families, and therefore it was chosen for further characterization ( Table 2). The sequences from round 12 were analyzed for the presence of consensus sequences, but were also screened based on their predicted secondary structures and the stability of those structures, as predicted by a Gibbs free energy value. Thirty to fifty random sequences were analyzed for the enrichment of consensus sequence families after every third round of selection (rounds 3, 6, 9, 12) to monitor the diversity of the library. This scheme was designed to enrich the ssDNA library to bind preferentially to alpha toxin in solution and to decrease binding to bovine serum albumin (BSA), toxin B, exotoxin A, and cholera toxin. ![]() The selection utilized a SELEX scheme previously described by our lab. Twelve rounds of in vitro selection were performed to identify a ssDNA MREs against alpha toxin ( Table 1, Figure 1). One or a few MREs with high affinities and specificities toward the target of interest can be identified at the end of the in vitro selection process. The library is then subject to repeated cycles of partitioning, amplification of bound library molecules, and removal of unbound molecules. For single-stranded DNA (ssDNA) MREs, the process begins with incubating a large random library of different ssDNA molecules (10 13 to 10 15) with the target of interest. The first nucleic acid MRE was described by the Gold laboratory in 1990, and was isolated using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX). They have high affinities and specificities toward the target of interest. MREs can be proteins (antibodies or antibody fragments), small peptides or nucleic acids (aptamers or SOMAmers). Single-stranded DNA molecular recognition elements (MRE) are an alternative to antibodies that have the potential to address the current limitations in diagnosing S. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant ( K d) of 93.7 ± 7.0 nM. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. aureus infections is crucial in benefiting patient health outcomes. aureus, rapid and accurate diagnosis of S. ![]() aureus related infections and the emergence of methicillin-resistant S. Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. ![]() |